Erratum: Cistrome and Epicistrome Features Shape the Regulatory DNA Landscape (Cell (2016) 165(5) (1280–1292))

Ronan C. O'Malley, Shao-Shan Huang, Liang Song, Mathew G. Lewsey, Anna Bartlett, Joseph R. Nery, Mary Galli, Andrea Gallavotti, Joseph R. Ecker

Research output: Contribution to journalComment/debate

Abstract

(Cell 165, 1280–1292; May 19, 2016) In the above article, we described an approach, termed “DNA Affinity Purification Sequencing” (DAP-seq) to probe specific transcription factor binding interactions with genomic DNA. The method relies on isolation of fragments of genomic DNA followed by ligation of specific adaptor oligonucleotides, which are later used to amplify the TF-bound fragments. In the Supplemental Experimental Procedures, the Adaptor B sequence shown was missing the 5′ phosphate modification required for ligation, and the Illumina TruSeq Index primer was shown as the reverse complement of the sequence used in the analyses. The correct sequences are: Adaptor B: 5′ P-GATCGGAAGAGCACACGTCTG and TruSeq Index primer: 5′-CAAGCAGAAGACGGCATACGAGAT-NNNNNN GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC (where the NNNNNN represents the six-base-pair sequence index used for sample identification). These changes, which have been made to the article online, will enable amplification of genomic DNA fragments in the system as described. We apologize for any inconvenience this error may have caused.

Original languageEnglish (US)
Number of pages1
JournalCell
Volume166
Issue number6
DOIs
StatePublished - Sep 8 2016

Fingerprint

DNA
Ligation
Oligonucleotides
Base Pairing
Purification
Amplification
Transcription Factors
Phosphates

ASJC Scopus subject areas

  • Biochemistry, Genetics and Molecular Biology(all)

Cite this

O'Malley, R. C., Huang, S-S., Song, L., Lewsey, M. G., Bartlett, A., Nery, J. R., ... Ecker, J. R. (2016). Erratum: Cistrome and Epicistrome Features Shape the Regulatory DNA Landscape (Cell (2016) 165(5) (1280–1292)). Cell, 166(6). https://doi.org/10.1016/j.cell.2016.08.063

Erratum : Cistrome and Epicistrome Features Shape the Regulatory DNA Landscape (Cell (2016) 165(5) (1280–1292)). / O'Malley, Ronan C.; Huang, Shao-Shan; Song, Liang; Lewsey, Mathew G.; Bartlett, Anna; Nery, Joseph R.; Galli, Mary; Gallavotti, Andrea; Ecker, Joseph R.

In: Cell, Vol. 166, No. 6, 08.09.2016.

Research output: Contribution to journalComment/debate

O'Malley, RC, Huang, S-S, Song, L, Lewsey, MG, Bartlett, A, Nery, JR, Galli, M, Gallavotti, A & Ecker, JR 2016, 'Erratum: Cistrome and Epicistrome Features Shape the Regulatory DNA Landscape (Cell (2016) 165(5) (1280–1292))', Cell, vol. 166, no. 6. https://doi.org/10.1016/j.cell.2016.08.063
O'Malley, Ronan C. ; Huang, Shao-Shan ; Song, Liang ; Lewsey, Mathew G. ; Bartlett, Anna ; Nery, Joseph R. ; Galli, Mary ; Gallavotti, Andrea ; Ecker, Joseph R. / Erratum : Cistrome and Epicistrome Features Shape the Regulatory DNA Landscape (Cell (2016) 165(5) (1280–1292)). In: Cell. 2016 ; Vol. 166, No. 6.
@article{5e8e2c57d07f42ef8f3181eb841d1d89,
title = "Erratum: Cistrome and Epicistrome Features Shape the Regulatory DNA Landscape (Cell (2016) 165(5) (1280–1292))",
abstract = "(Cell 165, 1280–1292; May 19, 2016) In the above article, we described an approach, termed “DNA Affinity Purification Sequencing” (DAP-seq) to probe specific transcription factor binding interactions with genomic DNA. The method relies on isolation of fragments of genomic DNA followed by ligation of specific adaptor oligonucleotides, which are later used to amplify the TF-bound fragments. In the Supplemental Experimental Procedures, the Adaptor B sequence shown was missing the 5′ phosphate modification required for ligation, and the Illumina TruSeq Index primer was shown as the reverse complement of the sequence used in the analyses. The correct sequences are: Adaptor B: 5′ P-GATCGGAAGAGCACACGTCTG and TruSeq Index primer: 5′-CAAGCAGAAGACGGCATACGAGAT-NNNNNN GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC (where the NNNNNN represents the six-base-pair sequence index used for sample identification). These changes, which have been made to the article online, will enable amplification of genomic DNA fragments in the system as described. We apologize for any inconvenience this error may have caused.",
author = "O'Malley, {Ronan C.} and Shao-Shan Huang and Liang Song and Lewsey, {Mathew G.} and Anna Bartlett and Nery, {Joseph R.} and Mary Galli and Andrea Gallavotti and Ecker, {Joseph R.}",
year = "2016",
month = "9",
day = "8",
doi = "10.1016/j.cell.2016.08.063",
language = "English (US)",
volume = "166",
journal = "Cell",
issn = "0092-8674",
publisher = "Cell Press",
number = "6",

}

TY - JOUR

T1 - Erratum

T2 - Cistrome and Epicistrome Features Shape the Regulatory DNA Landscape (Cell (2016) 165(5) (1280–1292))

AU - O'Malley, Ronan C.

AU - Huang, Shao-Shan

AU - Song, Liang

AU - Lewsey, Mathew G.

AU - Bartlett, Anna

AU - Nery, Joseph R.

AU - Galli, Mary

AU - Gallavotti, Andrea

AU - Ecker, Joseph R.

PY - 2016/9/8

Y1 - 2016/9/8

N2 - (Cell 165, 1280–1292; May 19, 2016) In the above article, we described an approach, termed “DNA Affinity Purification Sequencing” (DAP-seq) to probe specific transcription factor binding interactions with genomic DNA. The method relies on isolation of fragments of genomic DNA followed by ligation of specific adaptor oligonucleotides, which are later used to amplify the TF-bound fragments. In the Supplemental Experimental Procedures, the Adaptor B sequence shown was missing the 5′ phosphate modification required for ligation, and the Illumina TruSeq Index primer was shown as the reverse complement of the sequence used in the analyses. The correct sequences are: Adaptor B: 5′ P-GATCGGAAGAGCACACGTCTG and TruSeq Index primer: 5′-CAAGCAGAAGACGGCATACGAGAT-NNNNNN GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC (where the NNNNNN represents the six-base-pair sequence index used for sample identification). These changes, which have been made to the article online, will enable amplification of genomic DNA fragments in the system as described. We apologize for any inconvenience this error may have caused.

AB - (Cell 165, 1280–1292; May 19, 2016) In the above article, we described an approach, termed “DNA Affinity Purification Sequencing” (DAP-seq) to probe specific transcription factor binding interactions with genomic DNA. The method relies on isolation of fragments of genomic DNA followed by ligation of specific adaptor oligonucleotides, which are later used to amplify the TF-bound fragments. In the Supplemental Experimental Procedures, the Adaptor B sequence shown was missing the 5′ phosphate modification required for ligation, and the Illumina TruSeq Index primer was shown as the reverse complement of the sequence used in the analyses. The correct sequences are: Adaptor B: 5′ P-GATCGGAAGAGCACACGTCTG and TruSeq Index primer: 5′-CAAGCAGAAGACGGCATACGAGAT-NNNNNN GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC (where the NNNNNN represents the six-base-pair sequence index used for sample identification). These changes, which have been made to the article online, will enable amplification of genomic DNA fragments in the system as described. We apologize for any inconvenience this error may have caused.

UR - http://www.scopus.com/inward/record.url?scp=84986266311&partnerID=8YFLogxK

UR - http://www.scopus.com/inward/citedby.url?scp=84986266311&partnerID=8YFLogxK

U2 - 10.1016/j.cell.2016.08.063

DO - 10.1016/j.cell.2016.08.063

M3 - Comment/debate

AN - SCOPUS:84986266311

VL - 166

JO - Cell

JF - Cell

SN - 0092-8674

IS - 6

ER -